View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7191_low_18 (Length: 222)
Name: NF7191_low_18
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7191_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 80 - 216
Target Start/End: Complemental strand, 46424844 - 46424708
Alignment:
| Q |
80 |
ttatatatctccacttttgcgtaggaacactaaaaattcttatttagggtactctctacagggtgaatcagtacaagccacattgtgtagtacttgtgaa |
179 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46424844 |
ttatacatctccacttttgcgtaggaacactaaaaattcttatttagggtactctctacagggtgaatcagtacaagccacattgtgtagtacttgtgga |
46424745 |
T |
|
| Q |
180 |
tatatacataaaaaagctaaaatttggatatattctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46424744 |
tatatacataaaaaagctaaaatttggatgtattctt |
46424708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University