View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7191_low_19 (Length: 207)
Name: NF7191_low_19
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7191_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 14 - 137
Target Start/End: Complemental strand, 17812385 - 17812262
Alignment:
| Q |
14 |
aatattaaaatcatagataacataaattagaacaaaactggagcctccaacccacttgacattcctgtcatgtacatcttgaaataattcccaaactaag |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17812385 |
aatattaaaaccatagataacataaattagaacaaaactggagcctccaacccacttgacattcctgtcatacacatcttgaaataattcccaaactaag |
17812286 |
T |
 |
| Q |
114 |
ttggtacgttttggaagaagcaga |
137 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
17812285 |
ttggtacgttttggaagaagcaga |
17812262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University