View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7191_low_19 (Length: 207)

Name: NF7191_low_19
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7191_low_19
NF7191_low_19
[»] chr1 (1 HSPs)
chr1 (14-137)||(17812262-17812385)


Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 14 - 137
Target Start/End: Complemental strand, 17812385 - 17812262
Alignment:
14 aatattaaaatcatagataacataaattagaacaaaactggagcctccaacccacttgacattcctgtcatgtacatcttgaaataattcccaaactaag 113  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||    
17812385 aatattaaaaccatagataacataaattagaacaaaactggagcctccaacccacttgacattcctgtcatacacatcttgaaataattcccaaactaag 17812286  T
114 ttggtacgttttggaagaagcaga 137  Q
    ||||||||||||||||||||||||    
17812285 ttggtacgttttggaagaagcaga 17812262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University