View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7191_low_20 (Length: 203)

Name: NF7191_low_20
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7191_low_20
NF7191_low_20
[»] chr7 (1 HSPs)
chr7 (1-193)||(44676624-44676816)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 44676624 - 44676816
Alignment:
1 gggtgggtggaagtgtaacaattgaagcaggttcacttttttggaaaacattttgggatatatatcgtatgttcttcttcatagcccatcgactagttct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44676624 gggtgggtggaagtgtaacaattgaagcaggttcacttttttggaaaacattttgggatatatatcgtatgttcttcttcatagcccatcgactagttct 44676723  T
101 accacctttacgtttgggaggtgtatccactatgattccttcttctgatggaatctctatatctttgatattattataatttgttgttgatgt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
44676724 accacctttacgtttgggaggtgtatccactatgattccttcttctgatggaatctctatctctttgatattattataatttgttgttgatgt 44676816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University