View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7191_low_21 (Length: 201)

Name: NF7191_low_21
Description: NF7191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7191_low_21
NF7191_low_21
[»] chr6 (1 HSPs)
chr6 (6-183)||(10768556-10768733)


Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 6 - 183
Target Start/End: Original strand, 10768556 - 10768733
Alignment:
6 ggagtagcagagaaagaaagcctcttccttgcagaaattgaagatggtgatggtgaagttttttgcattactctagactttgcctttgctgaactagtga 105  Q
    |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10768556 ggagaagcagggaaagaaagcctcttccttgcagaaattgaagatggtgatggtgaagttttttgcattactctagactttgcctttgctgaactagtga 10768655  T
106 gtgccatgtaactaggaaacaccggcgagctttcaacgcttgcatcgtctcttaccgatgatcctgcaatgctactat 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10768656 gtgccatgtaactaggaaacaccggcgagctttcaacgcttgcatcgtctcttaccgatgatcctgcaatgctactat 10768733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University