View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7192_high_14 (Length: 298)
Name: NF7192_high_14
Description: NF7192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7192_high_14 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 317997 - 317771
Alignment:
| Q |
1 |
tggaggggatgtcaaattggataaattgggtggtagagccttttactattactttgttgaagctcaacattccaaagaaacacttccccttcttctttgg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
317997 |
tggagggtatgtcaaattggataaattgggtggtagagccttttactattactttgttgaagctcaacattctaaagaaacacttccccttcttctttgg |
317898 |
T |
|
| Q |
101 |
ctcaatggaggtaaaaataatctatctattgttattattaaatttgattgactagtctttgttcataatgtaccttgttggttgttcaagtgtcctgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
317897 |
ctcaatggaggtaaaaataatctatctattgttattattaaatttgattgactagtctttgttcataatgtaccttgttggttgttcaagtgtcctgaaa |
317798 |
T |
|
| Q |
201 |
ttaatgtgacaactatttttgtgcttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
317797 |
ttaatgtgacaactatttttgtgcttt |
317771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 219 - 280
Target Start/End: Original strand, 318260 - 318321
Alignment:
| Q |
219 |
ttgtgcttttatttgttgtgtctttctatgaagattcacaagggggaatgaagatatatatg |
280 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
318260 |
ttgtgtttttatttgttgtgtctttctatgaagattcacaagggggaatgaagatatatatg |
318321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 41 - 113
Target Start/End: Complemental strand, 11088170 - 11088098
Alignment:
| Q |
41 |
ttttactattactttgttgaagctcaacattccaaagaaacacttccccttcttctttggctcaatggaggta |
113 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| ||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
11088170 |
ttttactattactttgtggaagctcatcattctaaagaaacattgcctcttcttctttggctcaatggaggta |
11088098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University