View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7192_high_18 (Length: 250)
Name: NF7192_high_18
Description: NF7192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7192_high_18 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 318090 - 318321
Alignment:
| Q |
1 |
cacaatttcttgtacctcaaattcactcctatcaatttgtgaatttcctttgtatttctccttgtgaagattgtcaagagctttaacttgttggtttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
318090 |
cacaatttcttgtacctcaaattcactcctatcaatttgtgaatttcctttgtatttctccttgtgaagattgtcaagagctttaacttgttggtttcca |
318189 |
T |
 |
| Q |
101 |
tggatttcaatcacaaagtatgaaagaattagaaaggatagaagaagagaataactatttgcttttctcattgtgtttttatttgttgtgtctttctatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
318190 |
tggatttcaatcacaaagtatgaaagaattagaaaggatagaagaagagaataactatttgcttttctcattgtgtttttatttgttgtgtctttctatg |
318289 |
T |
 |
| Q |
201 |
aagattcacaagggggaatgaagatatatatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
318290 |
aagattcacaagggggaatgaagatatatatg |
318321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University