View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7197_high_5 (Length: 254)
Name: NF7197_high_5
Description: NF7197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7197_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 108 - 243
Target Start/End: Complemental strand, 12703618 - 12703480
Alignment:
| Q |
108 |
ttcaactatctctcatgcttgttttggcggtgctatgaagttcaaagaca---attggaagttggtaaagagagaagattatgagaatgaacaacttgaa |
204 |
Q |
| |
|
|||||||| ||||||||| ||||||| |||||||||||||| ||||||| || |||||||| ||| | | ||||||||||||||||||||||||||| |
|
|
| T |
12703618 |
ttcaactacctctcatgcaagttttggtggtgctatgaagttaaaagacattaatgggaagttgctaatgggtgaagattatgagaatgaacaacttgaa |
12703519 |
T |
 |
| Q |
205 |
aggagtggtattactgaggaacttgaccaacctgtctct |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12703518 |
aggagtggtattactgaggaacttgaacaacctgtctct |
12703480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 250
Target Start/End: Complemental strand, 8207427 - 8207358
Alignment:
| Q |
181 |
gattatgagaatgaacaacttgaaaggagtggtattactgaggaacttgaccaacctgtctctgctcctc |
250 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||||||| |||||||||| | |||||| |
|
|
| T |
8207427 |
gattatgagaatgaacaactcgaaaggagtggtataaccgaggaacttgaacaacctgtctgttctcctc |
8207358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University