View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7197_low_6 (Length: 254)

Name: NF7197_low_6
Description: NF7197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7197_low_6
NF7197_low_6
[»] chr1 (2 HSPs)
chr1 (108-243)||(12703480-12703618)
chr1 (181-250)||(8207358-8207427)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 108 - 243
Target Start/End: Complemental strand, 12703618 - 12703480
Alignment:
108 ttcaactatctctcatgcttgttttggcggtgctatgaagttcaaagaca---attggaagttggtaaagagagaagattatgagaatgaacaacttgaa 204  Q
    |||||||| |||||||||  ||||||| |||||||||||||| |||||||   || |||||||| ||| | | |||||||||||||||||||||||||||    
12703618 ttcaactacctctcatgcaagttttggtggtgctatgaagttaaaagacattaatgggaagttgctaatgggtgaagattatgagaatgaacaacttgaa 12703519  T
205 aggagtggtattactgaggaacttgaccaacctgtctct 243  Q
    |||||||||||||||||||||||||| ||||||||||||    
12703518 aggagtggtattactgaggaacttgaacaacctgtctct 12703480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 250
Target Start/End: Complemental strand, 8207427 - 8207358
Alignment:
181 gattatgagaatgaacaacttgaaaggagtggtattactgaggaacttgaccaacctgtctctgctcctc 250  Q
    |||||||||||||||||||| |||||||||||||| || ||||||||||| |||||||||| | ||||||    
8207427 gattatgagaatgaacaactcgaaaggagtggtataaccgaggaacttgaacaacctgtctgttctcctc 8207358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University