View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7199_high_5 (Length: 229)
Name: NF7199_high_5
Description: NF7199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7199_high_5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 3 - 229
Target Start/End: Original strand, 15803749 - 15803973
Alignment:
| Q |
3 |
agtggactttgcagcatctgctgaaatatcttcctcttctacttctgtttctatcatatgattctaagatttcttcaggaaatccatgtccttcattact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
15803749 |
agtggactttgcagcatctgctgaaatatcttcctcttctacttctatttctatcatatgattccaagatttcttcaggaaatccatgtc---cattact |
15803845 |
T |
 |
| Q |
103 |
ctgactggagtatgatcatcatgttccttttcctcctcatttgcctcaactggtgaaacatggcgttgactgtcagc-acaaaagaaccttgtgaaactg |
201 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15803846 |
ctgactggagtatgatcagcatgttcctcttcctcctcatttgcctcaactggtgaatcatggcgttgactgtcagcaacaaaagaaccttgtgaaactg |
15803945 |
T |
 |
| Q |
202 |
tttcatcatcttcacaactttcaacgtt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
15803946 |
tttcatcatcttcacaactttcaacgtt |
15803973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University