View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7199_low_1 (Length: 326)
Name: NF7199_low_1
Description: NF7199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7199_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 34976805 - 34976608
Alignment:
| Q |
1 |
tcagggttaatataaacagtgtaagattattgttgcagttgtcatacttctttgccgaaccagagacagaataagtcgccaacaaaatcataatcaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976805 |
tcagggttaatataaacagtgtaagattattgttgcagttgtcatacttctttgccgaaccagaaacagaataagtcgccaacaaaatcataatcaaaac |
34976706 |
T |
|
| Q |
101 |
catttttccattagatgaggtcgaatcaaacaccactacgaaactatatcatgaatcatgtatagtaacagataatttaaatccaagtcaatcttaag |
198 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976705 |
cttttttccattagatgaggtcgaatcaaacaccactacgaaactatatcacgaatcatgtatagtaacagataatttaaatccaagtcaatcttaag |
34976608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 277 - 326
Target Start/End: Complemental strand, 34976529 - 34976480
Alignment:
| Q |
277 |
tctgtagtattctttctataagtcttctttgcacacatctaaaccacata |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34976529 |
tctgtagtattctttctataagtcttctttgcacacatctaaaccacata |
34976480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University