View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7201_low_1 (Length: 392)
Name: NF7201_low_1
Description: NF7201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7201_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 157 - 385
Target Start/End: Complemental strand, 23377872 - 23377644
Alignment:
| Q |
157 |
aatattatcatttgctgctattgccataaataaatcactacgttccaaattccaatgattatacaccacatgacacaaacaaataacacgtagaagccat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23377872 |
aatattatcatttgctgctattgccataaataaatcactacgttccaaattccaatgattatacaccacatgacacaaacaaataacacgtagaagccat |
23377773 |
T |
|
| Q |
257 |
aatgatcataaccaaaatcaaaacaaacataacttgtatacagttggaatcacgtcttatcccaccccagtaacaaggaattcgacataaccagaatagt |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23377772 |
aatgatcataaccaaaatcaaaacaaacatacctcgtatacagttggaatcacgtcttatcccaccccagtaacaaggaattcgacataaccagaatagt |
23377673 |
T |
|
| Q |
357 |
tattgtaacactttgatttatgatgtcca |
385 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23377672 |
tattgtaacactttgatttatgatgtcca |
23377644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 23378031 - 23377935
Alignment:
| Q |
1 |
cttcataatgattgtagaatgatttcgatctcatccagttccttagatttcgttgctattacctttattaattnnnnnnntgcggcaatactagccg |
97 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23378031 |
cttcataatgattgtagaatgattttgatctcatccagttccttagatttcgttgctattacctttattaattaaaaaaatgcggcaatactagccg |
23377935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University