View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7201_low_7 (Length: 261)
Name: NF7201_low_7
Description: NF7201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7201_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 23 - 243
Target Start/End: Complemental strand, 3916961 - 3916742
Alignment:
| Q |
23 |
actaaaatcgccttcgaagttttgtgagagcattgagtatcttttttaggagctttgaaaaataaaaagaattagcattttcatctgaaattgaagcttt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3916961 |
actaaaatcgccttcgaagttttgtgagagcattgagtat-ttttttaggacctttgaaaaataaaaagaattagtattttcatctgaaattgaagcttt |
3916863 |
T |
 |
| Q |
123 |
caagaaacaactaactagtaattacattcacacaagcatgaacaacaaattaagaatgttacactattgaaaatatatcaacatgtaatgaacttttcca |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||| ||||||||||| ||||||||||| ||||||||| |||| |
|
|
| T |
3916862 |
caagaaacaactaactagtaattactttcacacaagcatgcacaacaaattaaaaatgttaaactattgaaaagatatcaacatggaatgaacttgtcca |
3916763 |
T |
 |
| Q |
223 |
tttgccaagtgcagacaaacc |
243 |
Q |
| |
|
||| |||||| ||||||||| |
|
|
| T |
3916762 |
ttttacaagtgaagacaaacc |
3916742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University