View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7203_low_13 (Length: 255)
Name: NF7203_low_13
Description: NF7203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7203_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 21 - 239
Target Start/End: Original strand, 41800196 - 41800422
Alignment:
| Q |
21 |
agaaattattttgactagtacacaaataccattttaaaacatgaa--tattgatgaactatttatgactattcatttcat------ggaaattattattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41800196 |
agaaattattttgactagtacacaaataccattttaaaacatgaacatattgatgaactatttatgactattcatttcatagggatggaaattattattt |
41800295 |
T |
|
| Q |
113 |
ttcttggagnnnnnnnctatttatcgaaatattatatagaaaattcctttatagttttgagataaggcgaaccaaagaacagtaaataccagctatggct |
212 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41800296 |
ttcttggagaaaaaaactatttatccaaatattatatagaaaattcctttatagttttgagataaggcgaaccaaagtacagtaaataccagctatggct |
41800395 |
T |
|
| Q |
213 |
ctccgcgtcaacacattcaccctctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41800396 |
ctccgcgtcaacacattcaccctctct |
41800422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University