View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7203_low_14 (Length: 251)
Name: NF7203_low_14
Description: NF7203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7203_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 233
Target Start/End: Complemental strand, 45790720 - 45790496
Alignment:
| Q |
10 |
aacaatatctacgcacccatatcagtaatcacacatctaatagtaagccatttttattaatattatgcaaatgacatttattgtgtcaaaagtcaaaatc |
109 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45790720 |
aacaatatctacacactcatatcagtaatcacacatctaatagtaagccatttttattaatactatgcaaatgacatttattgtgtcaaaaatcaaaatc |
45790621 |
T |
 |
| Q |
110 |
aatttcacatctataattgacaaccagtttcagctaaaggcaattttacaaactctaatccaaacacaaacac-agtgtgttcaccccatcgtccaattt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45790620 |
aatttcacatctataattgacaaccagtttcagctaaaggcaattttacaaactctaatccaaacacaaacacaagtgtgttcaccccatcgtccaattt |
45790521 |
T |
 |
| Q |
209 |
ccctcaagaaaaaccaagaactact |
233 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
45790520 |
ccctcaagaaaaactaagaactact |
45790496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University