View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7203_low_6 (Length: 357)

Name: NF7203_low_6
Description: NF7203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7203_low_6
NF7203_low_6
[»] chr7 (1 HSPs)
chr7 (19-164)||(45761831-45761978)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 45761978 - 45761831
Alignment:
19 taataagtccacttattattaatatttgtgaaataaacttctgaactttagggtgtgtcaa--ctcttctcgtcaccacaaaaacttttcaagggctgaa 116  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||    
45761978 taataagtccacttattattaatatttgtgaaacaaacttctgaactttagggtgtgtcaactctcttctcgtcaccacaaaaacttttcaagggttgaa 45761879  T
117 catgcagaacttcaaatcctnnnnnnnntctcttgattttaacaccaa 164  Q
    ||||||||||||||||||||        ||||||||||||||||||||    
45761878 catgcagaacttcaaatcctaaagaaaatctcttgattttaacaccaa 45761831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University