View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7203_low_6 (Length: 357)
Name: NF7203_low_6
Description: NF7203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7203_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 45761978 - 45761831
Alignment:
| Q |
19 |
taataagtccacttattattaatatttgtgaaataaacttctgaactttagggtgtgtcaa--ctcttctcgtcaccacaaaaacttttcaagggctgaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45761978 |
taataagtccacttattattaatatttgtgaaacaaacttctgaactttagggtgtgtcaactctcttctcgtcaccacaaaaacttttcaagggttgaa |
45761879 |
T |
 |
| Q |
117 |
catgcagaacttcaaatcctnnnnnnnntctcttgattttaacaccaa |
164 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45761878 |
catgcagaacttcaaatcctaaagaaaatctcttgattttaacaccaa |
45761831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University