View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7204_high_2 (Length: 419)
Name: NF7204_high_2
Description: NF7204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7204_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 1 - 408
Target Start/End: Original strand, 3424073 - 3424479
Alignment:
| Q |
1 |
tattgcacccaacgtgttctcgatggacacgttgagtagaagtttcgatggcctaagaagagagtcattggattccgttgtatccaacggaaatttgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424073 |
tattgcacccaacgtgttctcgatggacacgttgagtagaagtttcgatggcctaagaagagagtcattggattccgttgtatccaacggaaatttgtct |
3424172 |
T |
|
| Q |
101 |
gtttgaggagtagaaacggtaccacccatgaaggcaaaga---agagagtttggatttcagtttacggcttttttcacaattttgctgttgttgtttgtt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||| | |
|
|
| T |
3424173 |
gtttgaggagtagaaacggtaccacccatgaaggcaaagacaaagagagtttggatttcagtttacggcttttttcactatgttgctgttgttgt----t |
3424268 |
T |
|
| Q |
198 |
acgagaaaggtggttttttcaaaagtgaaagggtgaaatttgagtttgtgggggcttaaatgagtgaaggaagcttctaggaaagtgcgatatttaactt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3424269 |
acgagaaaggtggttttttcaaaagtgaaagggtgaaatttgagtttgtgggggcttaaatgagtgaaggaagcttctaggaaagtgcgatatttaaatt |
3424368 |
T |
|
| Q |
298 |
atatttggatttgagaggttggttttgaggcttgctgcaagatcccgaattttccagcagtgacctgacaaataatagcctcatcatccctaaacagtga |
397 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424369 |
atatttggatttgagaggttggtttttaggcttgctgcaagatcccgaattttccagcagtgacctgacaaataatagcctcatcatccctaaacagtga |
3424468 |
T |
|
| Q |
398 |
ggttttgatgt |
408 |
Q |
| |
|
||| ||||||| |
|
|
| T |
3424469 |
ggtgttgatgt |
3424479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University