View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7204_low_8 (Length: 237)
Name: NF7204_low_8
Description: NF7204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7204_low_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 237
Target Start/End: Original strand, 31308998 - 31309221
Alignment:
| Q |
14 |
caagaagatccatacccctcctcaaacacctcctctcaacccgatcccaatccgaaccattcactatctcaaagcgatgtgtaacctacatgcaccgtcc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31308998 |
caagaagatccatacccctcctcaaacacctcctctcaacccgatcccaatccgaaccattcactatctcaaagcgatgcgtaacctacatgcaccgtcc |
31309097 |
T |
|
| Q |
114 |
cggcgatggaaccccccgtcccgtaaccctaatcccaggcgacgggatcggcccactcgtaaccggcgccgttgagcaactaatggaagcgatgcacgcg |
213 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31309098 |
cggcgacggaactccccgtcccgtaaccctaatccccggcgacgggatcggcccactcgtaaccggcgccgttgagcaactaatggaagcgatgcacgcg |
31309197 |
T |
|
| Q |
214 |
ccagtttacttcgagaaattcgac |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31309198 |
ccagtttacttcgagaaattcgac |
31309221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 94 - 236
Target Start/End: Complemental strand, 9434709 - 9434567
Alignment:
| Q |
94 |
gtaacctacatgcaccgtcccggcgatggaaccccccgtcccgtaaccctaatcccaggcgacgggatcggcccactcgtaaccggcgccgttgagcaac |
193 |
Q |
| |
|
||||||||||||| ||| ||||| || ||||||||||| |||||||||||||||| ||||| ||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
9434709 |
gtaacctacatgccccgccccggagacggaaccccccgcaccgtaaccctaatccccggcgatgggatcggccctctcgttaccggcgctgttgagcaag |
9434610 |
T |
|
| Q |
194 |
taatggaagcgatgcacgcgccagtttacttcgagaaattcga |
236 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9434609 |
taatggaagcgatgcatgcgccagtgctcttcgagaaattcga |
9434567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University