View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7205_high_3 (Length: 330)
Name: NF7205_high_3
Description: NF7205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7205_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 8 - 315
Target Start/End: Complemental strand, 38831592 - 38831285
Alignment:
| Q |
8 |
gagatgaaagccaaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaaggaaacttattggaaagcatcaatttcga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38831592 |
gagatgaaagccaaagagaaatggaggagaatttatcaattgagacatgtgactttgctgatctttccgaagggaacttattggaaagcatcaatttcga |
38831493 |
T |
 |
| Q |
108 |
attcgatgatgatttcttcgtatgtttcaacgacggagatgtgttaccggatcttgagatggacccggaaatgcttgctgaattctccctcagcagcagc |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831492 |
attcgatgatgatttcttcgtatgcttcaacgacggagatgtgttaccggatcttgagatggacccggaaatgcttgctgaattctccctcagcagcagc |
38831393 |
T |
 |
| Q |
208 |
ggtgaggaatcggatataaattcgtcgggtgcaaatagcaaatcttgtaatgatgggaatatggttagtattgagagaaaattacaagatgaagagaaag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831392 |
ggtgaggaatcggatataaattcgtcgggtgcaaatagcaaatcttgtaatgatgggaatatggttagtattgagagaaaattacaagatgaagagaaag |
38831293 |
T |
 |
| Q |
308 |
tagtttat |
315 |
Q |
| |
|
|||||||| |
|
|
| T |
38831292 |
tagtttat |
38831285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 56 - 107
Target Start/End: Original strand, 30463872 - 30463923
Alignment:
| Q |
56 |
gtgactttgctgatctttccgaaggaaacttattggaaagcatcaatttcga |
107 |
Q |
| |
|
||||||||| || |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30463872 |
gtgactttggcgacctttccgaaggaaatttattggaaagcatcaacttcga |
30463923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University