View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7207_high_12 (Length: 219)
Name: NF7207_high_12
Description: NF7207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7207_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 45018676 - 45018503
Alignment:
| Q |
19 |
gattttcggtgcactgtggaacttggtggtggtggctagctttgacagaccattttcttacatgtctcattgcatatgcatcctcccttcttgcataggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45018676 |
gattttcggtgcactgtggaacttggtggtgg---ctagctttgacagaccattttcttacatgtctcattgcatatgcatcctcccttcttgcataggg |
45018580 |
T |
|
| Q |
119 |
ccttatatatagtccatgacatgttttcagttgttttgtgtgacacaatgtaaacattggaggattttccatgaactctga |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45018579 |
cct----tatagtccatgacatgttttcagttgttttgtgtgacacaatgtaaacattggaggattttccatgaactctga |
45018503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 191
Target Start/End: Original strand, 3173127 - 3173169
Alignment:
| Q |
149 |
ttgttttgtgtgacacaatgtaaacattggaggattttccatg |
191 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3173127 |
ttgttttgtgtgacacaatgtaaacggaggaggattttccatg |
3173169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University