View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7207_high_5 (Length: 343)
Name: NF7207_high_5
Description: NF7207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7207_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 53 - 325
Target Start/End: Complemental strand, 49794152 - 49793880
Alignment:
| Q |
53 |
tgctaactaacatatgcaaatgaaatgcatggttcttttgttgtatttacaggtaaagttttaaatatcgttgttccccaaaggtacaactggtccctat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49794152 |
tgctaactaacatatgcaaatgaaatgcatggttcttttgttgtatttacaggtaaagttttaaatatcgttgttccccaaaggtacaactggtccctat |
49794053 |
T |
 |
| Q |
153 |
tattgcgcttttagcatggccacactaatttacagaatagacaaaatgtggtcactactttcatcatatttaagggaactgagaatacaacttgatcttt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49794052 |
tattgcgcttttagcatggccacactaatttacagaatagacaaaatgtggtcactactttcatcatatttaagggaactgagaatacaacttgatcttt |
49793953 |
T |
 |
| Q |
253 |
tagaatacaagttagatagaaaatatgaatnnnnnnnnngttgatacaaatattttagatagaaagtaaaatc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49793952 |
tagaatacaagttagatagaaaatatgaataaaaaaaaagttgatacaaatattttagatagaaagtaaaatc |
49793880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University