View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7207_low_12 (Length: 234)
Name: NF7207_low_12
Description: NF7207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7207_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 24633658 - 24633868
Alignment:
| Q |
13 |
atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24633658 |
atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta |
24633757 |
T |
|
| Q |
113 |
gtgagataatggctgttttggcattgacaacatccttagctgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24633758 |
gtgagataatggctgttttggcattgacaacatccttaactgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt |
24633857 |
T |
|
| Q |
213 |
aactgctgatg |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
24633858 |
aactgctgatg |
24633868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 52497097 - 52496887
Alignment:
| Q |
13 |
atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52497097 |
atggacatcaatgaccggttcttaaggaaaattactgttggccagggacctgatgagaaaggaatggtacgagaaacagcatttgatatttcagttgcta |
52496998 |
T |
|
| Q |
113 |
gtgagataatggctgttttggcattgacaacatccttagctgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52496997 |
gtgagataatggctgttttggcattgacaacatccttaactgatatgcgggagaggctagggaaaatggtaattggaaacagcaagagtggtgaccctgt |
52496898 |
T |
|
| Q |
213 |
aactgctgatg |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
52496897 |
aactgctgatg |
52496887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University