View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7208_high_11 (Length: 250)
Name: NF7208_high_11
Description: NF7208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7208_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 4774870 - 4774752
Alignment:
| Q |
118 |
tgaaggaaacggtttattttattgttccgtaaacaaaaattgatatcgattcttaaaagaaagacattgatgcatttaagtaaggggaagagattatctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774870 |
tgaaggaaacggtttattttattgttccgtaaacaaaaattgatatcgattcttaaaagaaagacattgatgcatttaagtaaggggaagagattatctc |
4774771 |
T |
 |
| Q |
218 |
ctgcgaaatgtttctccag |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4774770 |
ctgcgaaatgtttctccag |
4774752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 4774986 - 4774941
Alignment:
| Q |
1 |
atcagtcattgctaaattagtgtttatttaaggtattaaccccaaa |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4774986 |
atcagtcattgctaaattagtgtttatttaagatattaaccccaaa |
4774941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University