View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7208_low_13 (Length: 299)

Name: NF7208_low_13
Description: NF7208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7208_low_13
NF7208_low_13
[»] chr8 (1 HSPs)
chr8 (1-282)||(13212753-13213034)
[»] chr5 (1 HSPs)
chr5 (62-142)||(3332356-3332436)
[»] chr1 (2 HSPs)
chr1 (92-140)||(16578617-16578665)
chr1 (88-140)||(32803226-32803278)
[»] chr3 (1 HSPs)
chr3 (74-111)||(46200932-46200969)


Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 13212753 - 13213034
Alignment:
1 gaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcgcgctgtccctcgtgatgatgataggtggtttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13212753 gaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcgcgctgtccctcgtgatgatgataggtggtttt 13212852  T
101 ggtttgtttttcgaacctgctggtcttcctcttggtcttcttcccatctcaccaccacttcctccaccagcacttccgctaccgccgtcgtcttttcctt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
13212853 ggtttgtttttcgaacctgctggtcttcctcttggtcttcttcccatctcaccaccacttcctccaccagcacttccgctaccaccgtcgtcttttcctt 13212952  T
201 ctcctccggtgggagtgttgttgccgtcttcgttgtttcgttctcttttttggcctcggcttaagctcccattgccactttg 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13212953 ctcctccggtgggagtgttgttgccgtcttcgttgtttcgttctcttttttggcctcggcttaagctcccattgccactttg 13213034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 62 - 142
Target Start/End: Original strand, 3332356 - 3332436
Alignment:
62 gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt 142  Q
    ||||| |||||||| |  |||||||| || |||||||||||||||||||| || || ||||||||||||||||||||||||    
3332356 gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt 3332436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 92 - 140
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
92 ggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc 140  Q
    |||||||||||||||||||| ||||| | ||||||||||||||||||||    
16578665 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 16578617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 88 - 140
Target Start/End: Original strand, 32803226 - 32803278
Alignment:
88 gataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc 140  Q
    |||||||||||||||| ||||||| || || | ||||||||||||||||||||    
32803226 gataggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc 32803278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 74 - 111
Target Start/End: Complemental strand, 46200969 - 46200932
Alignment:
74 tccctcgtgatgatgataggtggttttggtttgttttt 111  Q
    ||||| |||||||| |||||||||||||||||||||||    
46200969 tcccttgtgatgataataggtggttttggtttgttttt 46200932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University