View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7208_low_3 (Length: 446)
Name: NF7208_low_3
Description: NF7208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7208_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 38 - 432
Target Start/End: Complemental strand, 7133422 - 7133028
Alignment:
| Q |
38 |
ggcccgtgaccagaatcgggatgttttgctacagaaccttgcctctgtagtcgaaggcagggataaggttctggtcgagatgtcccgccttgctgttttg |
137 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7133422 |
ggcccgtgatcagaatcgggatgttttgctacagaaccttgcctctgtagtcgaaggcagggataaggttctggtcgagatgtcccgccttgctgttttg |
7133323 |
T |
|
| Q |
138 |
gaaggtaggtttcgacctggcagtggtttcaatttggaagaggcccgtgctagtctggaggccagttttgccaatgaagctgaaatagttttcactactg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7133322 |
gaaggtaggtttcgacctggcagtggtttcaatttggaagaggcccgtgctagtctggaggccagttttgccaatgaagctgaaatagttttcactactg |
7133223 |
T |
|
| Q |
238 |
tttctagcagtggccgcaagttgttttctcgtctttcccatggatttgatatggtagtaattgacgaggcagcccaagccagtgaagtgggagttcttcc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7133222 |
tttctagcagtggccgcaagttgttttctcgtctttcccatggatttgatatggtagtaattgacgaggcagcccaagccagtgaggtgggagttcttcc |
7133123 |
T |
|
| Q |
338 |
tcccctttctcttggggcagcacgatgtgttcttgttggagatcctcaacagcttcctgctacagttatcagcaaggctgcaggaacattgatgt |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7133122 |
tcccctttctcttggggcagcacgatgtgttcttgttggagatcctcaacagcttcctgctacagttatcagcaaggctgcaggaaccttgatgt |
7133028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University