View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7209_low_2 (Length: 407)
Name: NF7209_low_2
Description: NF7209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7209_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 1 - 390
Target Start/End: Complemental strand, 30262463 - 30262074
Alignment:
| Q |
1 |
gaatggtgatggcaatgataagcctcttcaggtctatgtgagaaggaaaacaaagaaatggagtgaagatactgaaggatgctgtgcttgctctccttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30262463 |
gaatggtgatggcaatgataagcctcttcaggtctatgtgagaaggaaaacaaagaaatggagtgaagatactgaaggatgccgtgcttgctctccttcc |
30262364 |
T |
 |
| Q |
101 |
aaattgaaaaagggatctacgttactccatggaaacaagccagccatcatttctgacggcagtgaaccatccatgtcaaaaattgttgtagaggagactg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30262363 |
aaattgaaaaagggatctatgttactccatggaaacaagccagccatcatttctgatggcagtgaaccatccatgtcaaaagttgttgtagaggagactg |
30262264 |
T |
 |
| Q |
201 |
ttttacatggtggtgtggctgaagccgaacccacgaacatcaatgtcgttgaagaggagactgatctgcatggtagtgttgctgatgctgaacccacaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30262263 |
ttttacatggtggtgtggctgaagccgaacccacgaacatcaatgtcgttgaagaggagactgatctgcatggtagtgttgctgatgctgaacccacaaa |
30262164 |
T |
 |
| Q |
301 |
catcaatgtggaagaaaatgatgatgaccttcctctttccttcttgcaaaacaagacaaggaggcgaaaaagacggcacactattcagat |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30262163 |
catcaatgtggaagaaaatgatgatgaccttcctctttccttcttgcaaaacaagacaaggaggcgaaaaagacggcacactattcagat |
30262074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University