View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7209_low_4 (Length: 337)
Name: NF7209_low_4
Description: NF7209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7209_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 329
Target Start/End: Complemental strand, 37848878 - 37848548
Alignment:
| Q |
1 |
tgtagttgttggtggttggatagtgattgggg-tggatggaatcgtgactggtgaaggtcaaagtaatgattggcaaaggttgaagtggtggttggcgat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37848878 |
tgtagttgttggtggttggatagtgattgggggtggatggaatcgtgactggtgaaggtcaaagtaatgattggcaaaggttgaagtggtggttggcgat |
37848779 |
T |
 |
| Q |
100 |
ggttggagtgatggttagtggaagttgaagtggtgtttaatagtag-caaagtggtaatcaacggtggttggtgtgataatcgacggtggtcaggtggat |
198 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
37848778 |
ggttggagtgatggttagtggaagtcgaagtggtggttaatagtagtcaaagtggtaatcaatggtggttggtgtgataatcgatggtggtcaagtggat |
37848679 |
T |
 |
| Q |
199 |
gatcaaatgttgataaagtggtgattgatgatggagagattggagattgaaatggttgtcatattggtagttcttttttgtcaagtattataccgttttt |
298 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37848678 |
gatcaaatgttgataaagtggggattgatgatggacagattggtggttgaaatggttgtcatattggtagttcttttttgtcaagtattataccgttttt |
37848579 |
T |
 |
| Q |
299 |
aacatacacagcaaaacaaattgtgatgtcc |
329 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
37848578 |
aacatacacaccaaaacaaattgtgatgtcc |
37848548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University