View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7210_low_6 (Length: 234)
Name: NF7210_low_6
Description: NF7210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7210_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 3563529 - 3563725
Alignment:
| Q |
17 |
acatcacatcgaccatactgtataatatattattaataaggttattgaaagtggccacgtttttattgtgccatctctcttatagtagtactattgatta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
3563529 |
acatcacatcgaccatactgtataatatattattaataaggttattgaaagtggccacgtttttattgtgccatctctcttctagt---actattgatta |
3563625 |
T |
 |
| Q |
117 |
tagtaggctagtagtaatagctcaggccaaaataagaaggacaatgattagcattttctagctagcaactacctagtagcaatagcattcctcttaattg |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3563626 |
tagtaggctagtagcaatagctcaggccaaaataagaaggacaatgattagcattttctagctagcaaatacctagtagcaatagcattcctcttaattg |
3563725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University