View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7212_low_1 (Length: 421)
Name: NF7212_low_1
Description: NF7212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7212_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 19 - 415
Target Start/End: Complemental strand, 19171537 - 19171141
Alignment:
| Q |
19 |
cagcaatatcaacagccgcatcaagaaccatctcccttttcgccacgtcagacattactcggctcgcgtgtttcgcgagccgaagagctttaagccgagc |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19171537 |
cagcaatatcaacagctgcatcaagaaccatctcccttttcgccacgtcagacattactcggctcgcgtgtttcgcgagccgaagagctttaagccgggc |
19171438 |
T |
|
| Q |
119 |
cggaagtctcagtaactgacatgacctcggtggctgagacccggcttggaccggagctgaaccgaggagagaaccttcgtagaaaattgacatggttgtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19171437 |
aggaagtctcagtaactgacatgacctcggtggctgagacccggcttggaccggagctgaaccgaggagagaaccttcgtagaaaattgacatggttgtt |
19171338 |
T |
|
| Q |
219 |
gatgagtagttaattggggctatgtttggattggtgacatggacagttagaagaacttctgcgtctacaacggggaggcttggttttaaggaggtgaagt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
19171337 |
gatgagtagttaattggagctatgtttggattggtgacatggacggttaaaagaacttctgcgtctacgacggggaggcttggttttaaggaagtgaagt |
19171238 |
T |
|
| Q |
319 |
tgatggagatgagatggaatgttgggtcttttggttttgctgagagaattgatgttgctgctactgctgatgctgctcctattattgctgatgtcca |
415 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19171237 |
tgatggagatgagatgaaatgttgggtcttttggttttgctgagagaattgatgttgctgctactgctgatgctgctcctattattgctgatgtcca |
19171141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University