View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7212_low_10 (Length: 214)

Name: NF7212_low_10
Description: NF7212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7212_low_10
NF7212_low_10
[»] chr7 (1 HSPs)
chr7 (13-200)||(42526103-42526290)


Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 200
Target Start/End: Complemental strand, 42526290 - 42526103
Alignment:
13 gagaagaacaggggaattgctcttattggacgaataaattcaagatccgagttggctgaagcttggcgttgaacatgtaaaggtgtatgttttttctatc 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42526290 gagaagaacaggggaattgctcttattggacgaataaattcaagatccgagttggctgaagcttggcgttgaacatgtaaaggtgtatgttttttctatc 42526191  T
113 ttgctgtctgggggaatgggatggatgacaagaaaaatggtactcaaataatctttgcgcatatgcgagttgcatgattgctgatgtc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42526190 ttgctgtctgggggaatgggatggatgacaagaaaaatggtactcaaataatctttgcgcatatgcgagttgcatgattgctgatgtc 42526103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University