View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7214_low_4 (Length: 243)
Name: NF7214_low_4
Description: NF7214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7214_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 224
Target Start/End: Original strand, 1832388 - 1832608
Alignment:
| Q |
2 |
atgtgccagcaggagcagatgactttatccctgtgctcatatatgttaccatcaaggcaaggctagccctccttggtaataatacattctgctgattttc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1832388 |
atgtgccagcaggagcagatgactttatccctgtgctcatatatgttaccatcaaggcaaggctagccctccttggtaataatacattctgctgattttc |
1832487 |
T |
|
| Q |
102 |
aaatatagtttattagccgttttttgcttatagattaaagcatgatcatgtttggtttccatgattaatgttgtttatttgttcgtaaaattttaagaaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1832488 |
aaatatagtttattagccgttttttgcttatagattaaagcatgagcatgtttggtttccatgattaatgttgtttatttgttcgtaaaattttaagaaa |
1832587 |
T |
|
| Q |
202 |
gacactgtaattaggggcccttg |
224 |
Q |
| |
|
||||| |||||||||| ||||| |
|
|
| T |
1832588 |
gacac--taattaggggtccttg |
1832608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University