View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7215_high_2 (Length: 443)
Name: NF7215_high_2
Description: NF7215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7215_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 264 - 424
Target Start/End: Original strand, 18518464 - 18518626
Alignment:
| Q |
264 |
tatgagagagaaaattgtcgcattttatctcaatcatttatccttgttgtccctctccttgttcatttatgtct--acgtttaaaattgatggaatttat |
361 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18518464 |
tatgagagagaaagttgtcgcattttatctcaatcatttatccttgttgtccctctccttgttcatttatgtctttacgtttaaaattgatggaatttat |
18518563 |
T |
 |
| Q |
362 |
aaaaacttcaacatttccatgtgtgtcggtcttaaaatcattctggactacaggggggcctga |
424 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18518564 |
aaaaactccaacatttccatgtgtgtcggtcttaaaatcattctggactacaggggggcctga |
18518626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 18518049 - 18518114
Alignment:
| Q |
1 |
atttgagggtgttgttagtcgagcttcatggggttgttaaatggacttcatcttctgctgatgttg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18518049 |
atttgagggtgttgttagtcgagcttcatggggttgttaaatggacttcatcttctgttgatgttg |
18518114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 32817698 - 32817754
Alignment:
| Q |
140 |
tttgatccttcgttgaataacaattctgtgaattatgacaagttttggtcttggagt |
196 |
Q |
| |
|
|||||||||| ||||| || ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
32817698 |
tttgatcctttgttgagaaataattcattgaattatgataagttttggtcttggagt |
32817754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University