View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7215_low_4 (Length: 203)
Name: NF7215_low_4
Description: NF7215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7215_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 3084234 - 3084066
Alignment:
| Q |
17 |
acatcagaagttgtgggctacctagtgcaccagctgatactatgatctcattcttagtcccatgactcaagtatgctctgtgttctgtccctcgcgcatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3084234 |
acatcagaagttgtgggctacctagtgcaccagctgatactatgatctcattcttagtcccatgattcaagtatgccctgtgttctgtccctcgtgcatc |
3084135 |
T |
|
| Q |
117 |
cttgaatagaactccatgtgcaacaggccttgaatttgatctttctgtttaatatcatacaccatgcat |
185 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3084134 |
cttgtatagaactccatgtgcaacaggccttgaatttgatctttctgtttaatatcatacaccatgcat |
3084066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 17 - 139
Target Start/End: Complemental strand, 3093114 - 3092992
Alignment:
| Q |
17 |
acatcagaagttgtgggctacctagtgcaccagctgatactatgatctcattcttagtcccatgactcaagtatgctctgtgttctgtccctcgcgcatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3093114 |
acatcagaagttgtgggctacctagtgcaccagctgatactatgatctcattcttagtcccatgattcaagtatgccctgtgttctgtccctcgtgcatc |
3093015 |
T |
|
| Q |
117 |
cttgaatagaactccatgtgcaa |
139 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
3093014 |
cttgtatagaactccatgtgcaa |
3092992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University