View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7216_high_2 (Length: 252)
Name: NF7216_high_2
Description: NF7216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7216_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 49 - 236
Target Start/End: Complemental strand, 35618009 - 35617833
Alignment:
| Q |
49 |
tgcactaaattgtctcatctattgcttgtggaataatcacaccatgcatgaattccacgttttattttattatggtccccaccatgatcctacccatttt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35618009 |
tgcactaaattgtctcatctattgcttgtggaata---------tgcatgaattccacgttttatt--attatggtccccaccatgatccaacccatttt |
35617921 |
T |
 |
| Q |
149 |
ctttgtccatttaagtcccacactctcacctcatctctcccacacctagaaactcacctcactccttttctctttccctaatcacaca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35617920 |
ctttgtccatttaagtcccacactctcacctcatctctcccacaactacaaactcacctcactccttttctctttccctaatcacaca |
35617833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University