View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7217_low_2 (Length: 247)
Name: NF7217_low_2
Description: NF7217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7217_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 3 - 236
Target Start/End: Original strand, 45122686 - 45122919
Alignment:
| Q |
3 |
aggaaatggatgttgaatatttgttagagatgtgccacgaagaaaaagagtttgttcgtgactgcatggcacagccggtagctggagctgcagtcgccgc |
102 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| || ||||| |
|
|
| T |
45122686 |
aggaaatgggtgtggaatatttgttagagatgtgccacgaagaaaaagagtttattcgtgacttcatggcacagccggtagctggagctgccgttgccgc |
45122785 |
T |
|
| Q |
103 |
caccgagagtagcagtgagatgattgtagtctctgatgagtcacctgagcttcttcctccgtccacatcctctagagcttgcgttatctctttgaataac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
45122786 |
caccgagagtagcagtgagatgattgtagtctctgatgagtcacctgagcttcttcctccgtccacatcctctagagcttgcattatctctttagataac |
45122885 |
T |
|
| Q |
203 |
tccgcggcaataccgttaccagctgtgatgtcca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45122886 |
tccgcggcaataccgttaccagctgtgatgtcca |
45122919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University