View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7218_low_6 (Length: 252)
Name: NF7218_low_6
Description: NF7218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7218_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 118 - 225
Target Start/End: Complemental strand, 7585386 - 7585279
Alignment:
| Q |
118 |
tgaatattttcatgaataataaactataaattcatgatgaaatcaagaaatctatgttaaagtaataggaattggagatccataccatatcaatttcagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7585386 |
tgaatattttcatgaataataaactataaattcatgatgaaatcaagaaatctatgttaaagtattaggaattggagatccataccatatcaatttcagc |
7585287 |
T |
|
| Q |
218 |
atcaatgg |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
7585286 |
atcaatgg |
7585279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 11 - 74
Target Start/End: Complemental strand, 7585455 - 7585392
Alignment:
| Q |
11 |
agaatatgcttgacaacatcaccaattttggctattgatgtttcccttgattgaacttaaaata |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7585455 |
agaatatgcttgacaacatcaccaattttggctattgatgtttcccttgattgaacttaaaata |
7585392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 7095759 - 7095801
Alignment:
| Q |
183 |
taggaattggagatccataccatatcaatttcagcatcaatgg |
225 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
7095759 |
taggaattggagatctataccatatcaattccagcaccaatgg |
7095801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 68
Target Start/End: Complemental strand, 20303058 - 20303003
Alignment:
| Q |
13 |
aatatgcttgacaacatcaccaattttggctattgatgtttcccttgattgaactt |
68 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||| |||||||| |||| |||||| |
|
|
| T |
20303058 |
aatatgctcaacaacatcaccaattctggctattggtgtttcccctgatcgaactt |
20303003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University