View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7218_low_7 (Length: 250)
Name: NF7218_low_7
Description: NF7218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7218_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 11173834 - 11173603
Alignment:
| Q |
1 |
tttgacagactcagggagctttataatgtccggagtttcaatagccaagctcttagcactgctctaccatctgaggatgaggtaaactttaatttataac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11173834 |
tttgacagactcagggagctttataatgtccggagtttcaatagccaagctcttagcactgctctaccatctgaggatgaggtaaactttaatttttaac |
11173735 |
T |
|
| Q |
101 |
attcatatatgatttcaagactcttaatatctaattattagattgtttcctttgaacagcaaagagaagcttcttactcaatgcatgaaactggaagtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11173734 |
attcatatatgatttcaagactcttaatatctaattattacattgtttcctttgaaaagcaaagagaagcttcttactcaatgcatgaaactggaagtgg |
11173635 |
T |
|
| Q |
201 |
aagcaatgtggctgcttgggaaaacaatgatc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11173634 |
aagcaatgtggctgcttgggaaaacaatgatc |
11173603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University