View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7219_high_10 (Length: 211)
Name: NF7219_high_10
Description: NF7219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7219_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 43101720 - 43101555
Alignment:
| Q |
18 |
acatattgatgcagcaatgacaattgaggcggatggtgatgataaggcgttgcagctgaactgggatcagatttatctgattctcgttcgcccactttac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43101720 |
acatattgatgcagcaatgacaattgaggcggatggtgatgatgaggcattgcagctgaactgggatcagatttatctgattcttgttcgcccactttac |
43101621 |
T |
|
| Q |
118 |
ttctaaagaagatggatttatggtaagaatatagcccctcgtacgacaaaaaggcagacagctaga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43101620 |
ttctaaagaagatggatttatggtaagaatatagcccctcgtacgacaaaaaggcagacagctaga |
43101555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 87 - 200
Target Start/End: Complemental strand, 3506261 - 3506148
Alignment:
| Q |
87 |
gatttatctgattctcgttcgcccactttacttctaaagaagatggatttatggtaagaatatagcccctcgtacgacaaaaaggcagacagctagactt |
186 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3506261 |
gatttatctgattcacgttcgcccactttacttctaaagaagatggatttatggtaagaatatagcccctcgtacgacaaaaaggcagacagctagactt |
3506162 |
T |
|
| Q |
187 |
ttgatcacaggttc |
200 |
Q |
| |
|
||||| | |||||| |
|
|
| T |
3506161 |
ttgattagaggttc |
3506148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 128 - 200
Target Start/End: Complemental strand, 21947933 - 21947861
Alignment:
| Q |
128 |
gatggatttatggtaagaatatagcccctcgtacgacaaaaaggcagacagctagacttttgatcacaggttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| | |||||| |
|
|
| T |
21947933 |
gatggatttatggtaagaatatagccccgcgtacgacaaaaaggcagacaggtagacttttgattagaggttc |
21947861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University