View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7219_high_5 (Length: 268)
Name: NF7219_high_5
Description: NF7219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7219_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 7 - 259
Target Start/End: Original strand, 8098838 - 8099090
Alignment:
| Q |
7 |
tttggtgtttgtattaaggatgcttatgtaacatccgttgatcgcaagggatttgatgtgctagcaaaagttacaggtcctgtttcaaaggacggcgttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8098838 |
tttggtgtttgtattaaggatgcttatgtaacatccgttgatcgcaagggatttgatgtgctagcaaaagttaccggtcctgtttcaaaggacggcgttg |
8098937 |
T |
 |
| Q |
107 |
gtcaataccaatggaaagagctcaggttcatgttcgagcaagaggcaaacgatgttgaaacattctgtcaacatctagttcaaatggaagaggaggtcat |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8098938 |
gtcaataccaatggaaagagcttaggttcatgttcgagcaagaggcaaacgatgttgaaacattctgtcaacatctagttcaaatggaagaggaggtcat |
8099037 |
T |
 |
| Q |
207 |
caaaaaggtttcagcctctagtggactaaactgaaacatgccaccttggttgg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8099038 |
caaaaaggtttcagcctctagtggactaaactgaaacatgccaccttggttgg |
8099090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University