View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7219_low_10 (Length: 268)
Name: NF7219_low_10
Description: NF7219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7219_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 8099137 - 8099341
Alignment:
| Q |
1 |
tagtcatatgacattgtatttttcatgatgtaaagagctgtcacattttactcttttttggtcaatgagaattaagtgcaaaagaatcattggtaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8099137 |
tagtcatatgacattgtatttttcatgatgtaaagagctgtcacattttactctttttttgtcaatgagaattaagtgcaaaagaatcattgctaatatt |
8099236 |
T |
 |
| Q |
101 |
tggcgtatttactacaactactacatgaaaatttgatgaattgtttgtcaagatggagaagacaagattttaaaaactaccagtatttagtttctgaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8099237 |
tggcgtatttactacaactactacttgaaagtttgatgaattgtttgttaagatggagaagacaagattttaaaaactaccagtatttagtttctgaatt |
8099336 |
T |
 |
| Q |
201 |
atagg |
205 |
Q |
| |
|
||||| |
|
|
| T |
8099337 |
atagg |
8099341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 203 - 252
Target Start/End: Original strand, 8099494 - 8099543
Alignment:
| Q |
203 |
agggctggttggatagacatatattcaaattatttgagtctgttggtata |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8099494 |
agggctggttggatagacatatattcaacttatttgagtctgttggtata |
8099543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University