View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7219_low_16 (Length: 214)
Name: NF7219_low_16
Description: NF7219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7219_low_16 |
 |  |
|
| [»] scaffold0055 (17 HSPs) |
 |  |  |
|
| [»] scaffold0052 (16 HSPs) |
 |  |  |
|
| [»] scaffold0021 (10 HSPs) |
 |  |  |
|
| [»] scaffold0152 (3 HSPs) |
 |  |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |  |
|
| [»] scaffold1084 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0055 (Bit Score: 168; Significance: 3e-90; HSPs: 17)
Name: scaffold0055
Description:
Target: scaffold0055; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 12495 - 12300
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12495 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattcgccgaagaaacgaaaaagcaaaccccccgtttgg |
12396 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacct |
196 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
12395 |
ctcccgaattgcaaaatgccaccttgccttggcttggcatgggcaggggaaggtctagtccaggccgcgaagaaaaatttcaaacgggtatcacct |
12300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #2
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 34418 - 34614
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34418 |
ccagcgagaaattttagcaaattttcacgtgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaacccc-cgtttgg |
34516 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| | ||||| | |||||||||||||||||| |
|
|
| T |
34517 |
ctcccgaattgcaaaatgccaccttgccttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacctta |
34614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #3
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 53590 - 53786
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53590 |
ccagcgagaaattttagcaaattttcacgtgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaacccc-cgtttgg |
53688 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| | ||||| | |||||||||||||||||| |
|
|
| T |
53689 |
ctcccgaattgcaaaatgccaccttgccttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacctta |
53786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #4
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 74590 - 74791
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
74590 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-cccccgtttgg |
74688 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
74689 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
74788 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
74789 |
tta |
74791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #5
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 43204 - 43405
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43204 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-cccccgtttgg |
43302 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| | ||||| | || |||||||||||| |
|
|
| T |
43303 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccagaccggtatgacc |
43402 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
43403 |
tta |
43405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #6
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 19815 - 19614
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19815 |
ccagcgagaaattttggaaaatttgcacgcgggattcgttaattgccaatattttaagcgtcattagccgaagaaacgaaaaagcaaac-ccccgtttgg |
19717 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
19716 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
19617 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
19616 |
tta |
19614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #7
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 55918 - 56119
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
55918 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-ccctcgtttgg |
56016 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||| | |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
56017 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtgtagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
56116 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
56117 |
tta |
56119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #8
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 35542 - 35731
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35542 |
ccagcgagaaattttagcaaattttcacgtgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-cccccgtttgg |
35640 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||| | ||||| | |||||||||||||||||| |
|
|
| T |
35641 |
ctcccgaattgcaaaatgccaccttgccttggcttggcat-------ggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacctta |
35731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 6 - 60
Target Start/End: Complemental strand, 11417 - 11363
Alignment:
| Q |
6 |
gagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11417 |
gagaaattttggcaattttgcacgcgggaatcgttaactgcgaatattttaagcg |
11363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 11246 - 11191
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11246 |
cgagaaattttggcaattttgcatgcgggaatcgttaactgcgaatattttaagcg |
11191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 18754 - 18699
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18754 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
18699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 30059 - 30004
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30059 |
cgagaaattttggcaattttgcacgcgggaatcgtaaactgcgaatattttaagcg |
30004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 36591 - 36646
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36591 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
36646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 44253 - 44308
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44253 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
44308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 56978 - 57033
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
56978 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
57033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 75640 - 75695
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
75640 |
cgagaaattttggcaattttgcacgtgggaatcgttaactgcgaatatcttaagcg |
75695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0055; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 30233 - 30178
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
30233 |
cgagaaatttgggcaattttgcacgcgggaatcgtcaactgcgaatattctaagcg |
30178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052 (Bit Score: 168; Significance: 3e-90; HSPs: 16)
Name: scaffold0052
Description:
Target: scaffold0052; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 72040 - 72235
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
72040 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattcgccgaagaaacgaaaaagcaaaccccccgtttgg |
72139 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacct |
196 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
72140 |
ctcccgaattgcaaaatgccaccttgccttggcttggcatgggcaggggaaggtctagtccaggccgcgaagaaaaatttcaaacgggtatcacct |
72235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #2
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 61646 - 61450
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
61646 |
ccagcgagaaattttagcaaattttcacgtgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccc-gtttgg |
61548 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| | ||||| | |||||||||||||||||| |
|
|
| T |
61547 |
ctcccgaattgcaaaatgccaccttgccttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacctta |
61450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #3
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 3697 - 3496
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3697 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaac-ccccgtttgg |
3599 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
3598 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
3499 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
3498 |
tta |
3496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #4
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 53524 - 53725
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
53524 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-ccctcgtttgg |
53622 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
53623 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
53722 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
53723 |
tta |
53725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #5
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 18222 - 18021
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18222 |
ccagcgagaaattttggaaaatttgcacgcgggattcgttaattgccaatattttaagcgtcattagccgaagaaacgaaaaagcaaac-ccccgtttgg |
18124 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
18123 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
18024 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
18023 |
tta |
18021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #6
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 41713 - 41512
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
41713 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-ccctcgtttgg |
41615 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||| | |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
41614 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtgtagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
41515 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
41514 |
tta |
41512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #7
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 30315 - 30474
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30315 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-cccccgtttgg |
30413 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctgg-----cttggcatgggcaggggaaggtct |
156 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30414 |
ctcccgaattgcaaaatgccaccttgccttggctaaacttggcatgggcaggggaaggtct |
30474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 6 - 60
Target Start/End: Original strand, 73118 - 73172
Alignment:
| Q |
6 |
gagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73118 |
gagaaattttggcaattttgcacgcgggaatcgttaactgcgaatattttaagcg |
73172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 2636 - 2581
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2636 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
2581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 17172 - 17117
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17172 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
17117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 40653 - 40598
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40653 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
40598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 54582 - 54637
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54582 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatatcttaagcg |
54637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 66006 - 66061
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
66006 |
cgagaaattttggcaattttgcacgcgggaatcgtaaactgcgaatattttaagcg |
66061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 73289 - 73344
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
73289 |
cgagaaattttggcaattttgcatgcgggaatcgttaactgcgaatattttaagcg |
73344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 42543 - 42598
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
42543 |
cgagaaattttggcaattttgcacgtgggaatcgttaactgcgaatatcttaagcg |
42598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0052; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 65832 - 65887
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
65832 |
cgagaaatttgggcaattttgcacgcgggaatcgtcaactgcgaatattctaagcg |
65887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 146; Significance: 4e-77; HSPs: 10)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 95813 - 96010
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
95813 |
ccagcgagaaattttagcaaatttgcacgcgggattcgttacttgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
95912 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
|||| ||||||||||||| ||||||||| |||||||||| |||||||||||||||| | ||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
95913 |
ctcccgaattgcaaaatgtcaccttgccttggcttggcacgggcaggggaaggtctagcccaagccgcaaaaaaaaatttcaaaccggtatgacctta |
96010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 49196 - 49397
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49196 |
ccagcgagaaattttggcaaatttgcacgcgggattcgttaattgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaa-cccccgtttgg |
49294 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgc-----cctggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacc |
195 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||| | ||||| | ||||||||||||||| |
|
|
| T |
49295 |
ctcccgaattgcaaaatgccaccttgccttggcttggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacc |
49394 |
T |
 |
| Q |
196 |
tta |
198 |
Q |
| |
|
||| |
|
|
| T |
49395 |
tta |
49397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #3
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 39276 - 39472
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
39276 |
ccagcgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatattttaagctttattagccgaagaaacgaaaaagcaaa-cccctgtttgg |
39374 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcg-gagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| || | ||||||||| |||||||||||||||| |
|
|
| T |
39375 |
ctcccgaattgcaaaatgccaccttgccttggcttggcatgggcaggggaaggtctcgtccaggccacgaaacaaaaatttc-aaccggtatgacctta |
39472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #4
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 10 - 169
Target Start/End: Original strand, 34511 - 34669
Alignment:
| Q |
10 |
aattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttggctccggaat |
109 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
34511 |
aattttggcaattttgcacgcgggaatcgttaactgcgaatattttaagcttcattagccgaagaaacgaaaaagcaaacccccc-tttggctcccgaat |
34609 |
T |
 |
| Q |
110 |
tgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcg |
169 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
34610 |
tgcaaaatgccaccttgccttggcttggcatgggcaggggaaggtctaggccaggccgcg |
34669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #5
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 50282 - 50478
Alignment:
| Q |
1 |
ccagcgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttgg |
100 |
Q |
| |
|
|||| |||| ||||| |||| | ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
50282 |
ccagagagagattttggcaattatgcacgcggaaatcgttaactgcgaatattttaagcgtcattagctgaagaaacgaaaaagcaaa-cccccgtttgg |
50380 |
T |
 |
| Q |
101 |
ctccggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggtctggtccaggccgcg-gagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||| | | | ||||||||| |||||||||||||||| |
|
|
| T |
50381 |
ctcccgaattgcaacatgccaccttgccttggcttggcatgggcaggggaaggtctagtccaggctgagaaacaaaaatttc-aaccggtatgacctta |
50478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 41085 - 41140
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41085 |
cgagaaattttggcaattttgcacgcgggaatcgttaactgcgaatattttaagcg |
41140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 6 - 60
Target Start/End: Original strand, 51426 - 51480
Alignment:
| Q |
6 |
gagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51426 |
gagaaattttggcaattttgcacgcgggaatcgttaactgcgaatattttaagcg |
51480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 40919 - 40971
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaa |
57 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40919 |
cgagaaattttggcaagtttgcacgcgggaatcgttaactgcgaatattttaa |
40971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 51597 - 51652
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51597 |
cgagaaattttggcaattttgcatgcgggaatcgttaactgcgaatattttaagcg |
51652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 58
Target Start/End: Original strand, 40745 - 40798
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaag |
58 |
Q |
| |
|
||||||||||| || | |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40745 |
cgagaaattttggcgattttgcacgagagaatcgttaactgcgaatattttaag |
40798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 5 - 154
Target Start/End: Complemental strand, 19309 - 19161
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttggctcc |
104 |
Q |
| |
|
||||||||||| || |||||||||| |||| ||||| | |||||||||||||||||||| |||||||||||| |||||| |||| |||| ||||||||| |
|
|
| T |
19309 |
cgagaaattttggcgaatttgcacgtgggattcgtttattgcgaatattttaagcgtcaatagccgaagaaatgaaaaaacaaa-ccccaatttggctcc |
19211 |
T |
 |
| Q |
105 |
ggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggt |
154 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||||| ||||||| |
|
|
| T |
19210 |
cgaattgcaaaatgtcgccttgccgtggcttggcatgggcaaaggaaggt |
19161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 5 - 154
Target Start/End: Original strand, 33403 - 33551
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttggctcc |
104 |
Q |
| |
|
||||||||||| || |||||||||| |||| ||||| | |||||||||||||||||||| |||||||||||| |||||| |||| |||| ||||||||| |
|
|
| T |
33403 |
cgagaaattttggcgaatttgcacgtgggattcgtttattgcgaatattttaagcgtcaatagccgaagaaatgaaaaaacaaa-ccccaatttggctcc |
33501 |
T |
 |
| Q |
105 |
ggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggt |
154 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||||| ||||||| |
|
|
| T |
33502 |
cgaattgcaaaatgtcgccttgccgtggcttggcatgggcaaaggaaggt |
33551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152; HSP #3
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 5 - 154
Target Start/End: Complemental strand, 38135 - 37987
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttggctcc |
104 |
Q |
| |
|
||||||||||| || |||||||||| |||| ||||| | |||||||||||||||||||| |||||||||||| |||||| |||| |||| ||||||||| |
|
|
| T |
38135 |
cgagaaattttggcgaatttgcacgtgggattcgtttattgcgaatattttaagcgtcaatagccgaagaaatgaaaaaacaaa-ccccaatttggctcc |
38037 |
T |
 |
| Q |
105 |
ggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggt |
154 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||||| ||||||| |
|
|
| T |
38036 |
cgaattgcaaaatgtcgccttgccgtggcttggcatgggcaaaggaaggt |
37987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 5 - 154
Target Start/End: Complemental strand, 11739 - 11591
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttggctcc |
104 |
Q |
| |
|
||||||||||| || |||||||||| |||| ||||| | |||||||||||||||||||| |||||||||||| |||||| |||| |||| ||||||||| |
|
|
| T |
11739 |
cgagaaattttggcgaatttgcacgtgggattcgtttattgcgaatattttaagcgtcaatagccgaagaaatgaaaaaacaaa-ccccaatttggctcc |
11641 |
T |
 |
| Q |
105 |
ggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggt |
154 |
Q |
| |
|
||||| ||||||| | ||||||| |||||||||||||||| ||||||| |
|
|
| T |
11640 |
cgaattccaaaatgtcgccttgccgtggcttggcatgggcaaaggaaggt |
11591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 5 - 154
Target Start/End: Original strand, 9477475 - 9477623
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttggctcc |
104 |
Q |
| |
|
||||||| ||| ||| |||||||| |||| ||||| | |||||||||||||||||| |||||||||||| |||||| |||| |||| ||||||||| |
|
|
| T |
9477475 |
cgagaaactttggcatttttgcacgagggatgagttaattacgaatattttaagcgtcaatagccgaagaaatgaaaaaacaaa-ccccaatttggctcc |
9477573 |
T |
 |
| Q |
105 |
ggaattgcaaaatgccaccttgccctggcttggcatgggcaggggaaggt |
154 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||||| ||||||| |
|
|
| T |
9477574 |
cgaattgcaaaatgtcgccttgccgtggcttggcatgggcaaaggaaggt |
9477623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 130 - 198
Target Start/End: Original strand, 30422382 - 30422450
Alignment:
| Q |
130 |
tggcttggcatgggcaggggaaggtctggtccaggccgcggagaaaaatttcaaaccggtatgacctta |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| | ||||| | |||||||||||||||||| |
|
|
| T |
30422382 |
tggcttggcatgggcaggggaaggtctagtccaggccgcgaaaaaaaaatccaaaccggtatgacctta |
30422450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 143
Target Start/End: Original strand, 21098529 - 21098666
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcgtcattagccgaagaaacgaaaaagcaaaccccccgtttggctcc |
104 |
Q |
| |
|
||||||||||| |||| |||||| | | || || |||| | |||||||||||||||||| |||||||| | | |||||| |||| ||| ||||| |||| |
|
|
| T |
21098529 |
cgagaaattttggcaattttgcatgagagattcattaattacgaatattttaagcgtcaatagccgaatatatgaaaaaacaaa-ccctagtttgcctcc |
21098627 |
T |
 |
| Q |
105 |
ggaattgcaaaatgccaccttgccctggcttggcatggg |
143 |
Q |
| |
|
||||||||||||||| | | | | |||||||||||||| |
|
|
| T |
21098628 |
cgaattgcaaaatgccgcatcgtcgtggcttggcatggg |
21098666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1084 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1084
Description:
Target: scaffold1084; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 60
Target Start/End: Complemental strand, 2934 - 2879
Alignment:
| Q |
5 |
cgagaaattttagcaaatttgcacgcgggaatcgttaactgcgaatattttaagcg |
60 |
Q |
| |
|
||||||||||| |||| |||||| |||| |||||| ||||| |||||||||||||| |
|
|
| T |
2934 |
cgagaaattttggcaattttgcaggcggaaatcgtcaactgtgaatattttaagcg |
2879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University