View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7220_low_5 (Length: 266)
Name: NF7220_low_5
Description: NF7220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7220_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 258
Target Start/End: Original strand, 25913368 - 25913611
Alignment:
| Q |
15 |
catcgtttttgtggttgaattgcaacagatatctgttctctgttgtgggaatgacatcaaatcccttcaccgtcctccagactgtgttcagccgttgttt |
114 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
25913368 |
catcgattttgtggttgaattgaaacaggtatctgttctctgttgtgggaatgacatcaaatcccttcaccggcctccaggttgtgctcagccgttgttt |
25913467 |
T |
|
| Q |
115 |
gaagtatgttagtcgtacctccttgtcagagagcaaacgactaatcaagcagtggtcttggatgatggagttttggacagaggcattaagatttagggtc |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||| |
|
|
| T |
25913468 |
gaagtatgttagtcgtacctccttatcagagagcacacgaccaatcaagcagtggtcttggatgatggagttttggacaaagacatcaagatttagggtc |
25913567 |
T |
|
| Q |
215 |
ataccctcatcttccagagttaaaccatcaagattgatgtccat |
258 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25913568 |
ataccctcatcttccagagttaagccatcaagattgatgtccat |
25913611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University