View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7221_high_14 (Length: 273)
Name: NF7221_high_14
Description: NF7221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7221_high_14 |
 |  |
|
| [»] scaffold0059 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0059 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 21189 - 21444
Alignment:
| Q |
1 |
acaatgacatcaaacctctcattacagatatgtcataaaagttactctagtctacttattcaagtcattgcccttatgtccaaccaacatatagagaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21189 |
acaatgacatcaaacctctcattacagatatgtcataaaagttattctagtctacttattcaagtcattgcccttatgtccaac----atatagagaaag |
21284 |
T |
 |
| Q |
101 |
tggagagagaggacataccctttcttacagggttatagtggttctactaaatcttttaaaattataaggtaacaaaccatactctttcttgaagagttga |
200 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21285 |
tggaga--gaggacataccctttcatatagggttatagtggttctactaaatcttttaaagttataaggtactaaaccatactctttcttgaagagttga |
21382 |
T |
 |
| Q |
201 |
atggttctacaccatcatgggatacactattcaaacacactcacctgtcaccatgtgatgtc |
262 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21383 |
atggttctacaccatcatggaatacactattcaaacacactcaccagtcaccatgtgatgtc |
21444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 29026728 - 29026683
Alignment:
| Q |
1 |
acaatgacatcaaacctctcattacagatatgtcataaaagttact |
46 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
29026728 |
acaatgacatcaaacctctcattaaagacattccataaaagttact |
29026683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University