View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7221_high_19 (Length: 253)
Name: NF7221_high_19
Description: NF7221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7221_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 43753974 - 43754200
Alignment:
| Q |
17 |
acatcactagtaccacgagactcaccaagctcactagtactaccctcaactacatcatctacaatgttagaaaccatgggctgctgcgtcataactggac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43753974 |
acatcactagtaccacgagactcaccaagctcactagtactaccctcaactacatcatctacaatgttagaaaccatgggctgctgcgtcataactggac |
43754073 |
T |
 |
| Q |
117 |
tttccaaggttcccacttcagcaatctctttctcttcagaattgctaatcgaatccgaattctcggacttctgaatgggagattcgggtaattcaacagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43754074 |
tttccaaggttcccacttcagcaatctctttctcttcagaattgctaatcgaatccgaattctcggacttctgaatgggagattcgggtaattcaacagg |
43754173 |
T |
 |
| Q |
217 |
catctccggtaactgctgatgtccatc |
243 |
Q |
| |
|
|||||||||||||||||| ||| |||| |
|
|
| T |
43754174 |
catctccggtaactgctgctgttcatc |
43754200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University