View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7221_low_21 (Length: 255)
Name: NF7221_low_21
Description: NF7221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7221_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 238
Target Start/End: Complemental strand, 41565131 - 41564901
Alignment:
| Q |
9 |
gagtgagaagaaacttgattgcttgactatgaagtaactgatattctt-taacgtgagacttctatcattaacattattctttaacgtaactcaaatctc |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41565131 |
gagtgtgaagaaacttgattgcttgactatgaagtaactgatactctaataacgtgagacttctatcattaacattattctttaacgtaactcaaatgtc |
41565032 |
T |
 |
| Q |
108 |
aacgaatatattgaatccaagctaaaatatgattccattaagtgagagaatttcatgacttaactttttaatctactcaattatatgaaactcctaaaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
41565031 |
aacgaatatattgaatccaagctaaaatatgattccattaagtgagagaatttcatgacttaacttttttatctactcaattataagaaactcctaaaat |
41564932 |
T |
 |
| Q |
208 |
acactaatctaaaaattgcctggatataatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
41564931 |
acactaatctaaaaattgcctggatacaatt |
41564901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University