View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7222_high_4 (Length: 242)
Name: NF7222_high_4
Description: NF7222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7222_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 41 - 225
Target Start/End: Complemental strand, 31281362 - 31281179
Alignment:
| Q |
41 |
tttaagcatggtcgaacactaaatagtaatatatcagcactgcctttgatgagattcaaaccatttgtccgattgtgggatattcatttttcctacaata |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
31281362 |
tttaagcatggtcgaacactaaatagtaatatatcagcacttcctttgatgagattcaaaccatttgtccaattgtgggatattcattttttctacaata |
31281263 |
T |
 |
| Q |
141 |
tactatgtcatgtcgtgacaatataagtattttcttttggtatagagagaattgaacaaaggatgggttagatggtattgcaagt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31281262 |
tactatgtcatgtcgtgacaatataagtattttcttctggtatagagagaattgaacaaaggatgggtt-gatggtattgcaagt |
31281179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University