View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7223_high_11 (Length: 273)

Name: NF7223_high_11
Description: NF7223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7223_high_11
NF7223_high_11
[»] chr6 (3 HSPs)
chr6 (6-152)||(3446542-3446694)
chr6 (188-261)||(3446407-3446480)
chr6 (221-261)||(3446503-3446543)


Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 6 - 152
Target Start/End: Complemental strand, 3446694 - 3446542
Alignment:
6 tggacatcatcagataagaagatattttgtccttttaataagacaaaatgttgtctgagaatcaattttagtggtgccctatagacgtaaaatattggac 105  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
3446694 tggacataatcagataagaagatattttgtccttttaataagacaaaatgttgtctgagaaccaattttagtggtgccctatagacgtaaaatattggac 3446595  T
106 atgttaataaactcatca------tgctagtgagtagagaaccaacttcagtg 152  Q
    ||||||||||||||||||      |||| ||||||||||||||||||||||||    
3446594 atgttaataaactcatcatgctcatgcttgtgagtagagaaccaacttcagtg 3446542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 188 - 261
Target Start/End: Complemental strand, 3446480 - 3446407
Alignment:
188 caagatggacctgtctctaaattcaagttccactgctaatttgagttttcaactgataatgatgccagtgatgt 261  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3446480 caagatggaccggtctctaaattcaagttccactgctaatttgagttttcaactgataatgatgccagtgatgt 3446407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 261
Target Start/End: Complemental strand, 3446543 - 3446503
Alignment:
221 tgctaatttgagttttcaactgataatgatgccagtgatgt 261  Q
    |||||||||||||||||||||||||||||||||||||||||    
3446543 tgctaatttgagttttcaactgataatgatgccagtgatgt 3446503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University