View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7223_high_11 (Length: 273)
Name: NF7223_high_11
Description: NF7223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7223_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 6 - 152
Target Start/End: Complemental strand, 3446694 - 3446542
Alignment:
| Q |
6 |
tggacatcatcagataagaagatattttgtccttttaataagacaaaatgttgtctgagaatcaattttagtggtgccctatagacgtaaaatattggac |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446694 |
tggacataatcagataagaagatattttgtccttttaataagacaaaatgttgtctgagaaccaattttagtggtgccctatagacgtaaaatattggac |
3446595 |
T |
 |
| Q |
106 |
atgttaataaactcatca------tgctagtgagtagagaaccaacttcagtg |
152 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
3446594 |
atgttaataaactcatcatgctcatgcttgtgagtagagaaccaacttcagtg |
3446542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 188 - 261
Target Start/End: Complemental strand, 3446480 - 3446407
Alignment:
| Q |
188 |
caagatggacctgtctctaaattcaagttccactgctaatttgagttttcaactgataatgatgccagtgatgt |
261 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446480 |
caagatggaccggtctctaaattcaagttccactgctaatttgagttttcaactgataatgatgccagtgatgt |
3446407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 261
Target Start/End: Complemental strand, 3446543 - 3446503
Alignment:
| Q |
221 |
tgctaatttgagttttcaactgataatgatgccagtgatgt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446543 |
tgctaatttgagttttcaactgataatgatgccagtgatgt |
3446503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University