View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7223_low_9 (Length: 334)
Name: NF7223_low_9
Description: NF7223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7223_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 148 - 316
Target Start/End: Complemental strand, 43691822 - 43691654
Alignment:
| Q |
148 |
acacaaatcaagaaaataaatatataagttagaagatttttcctttagagtagtttaattgactcttgattcatgctttttcccagaggctcaacacgag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43691822 |
acacaaatcaagaaaataaatatataagttagaagatttttcctttagagtagtttaattgactcttgattcatgctttttcccagaggctcaacacgag |
43691723 |
T |
 |
| Q |
248 |
ttcacggcaagttccaatggctggggtattggatctttggtctcttcaactgttcttcatgatcctcat |
316 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43691722 |
ttcacggcaagttccaatggctggggtgttggatctttggtctcttcaactgttcttcatgatcctcat |
43691654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 14 - 78
Target Start/End: Complemental strand, 43691956 - 43691892
Alignment:
| Q |
14 |
tgtgtaatttaagttgtttgtacttaaccaggtcgacagcaacaggacaatcttctctgatggta |
78 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43691956 |
tgtgaaatttaagttgtttgtacttaaccaggtcgacagcaacaggacaatcttctctgatggta |
43691892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University