View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7224_high_7 (Length: 345)
Name: NF7224_high_7
Description: NF7224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7224_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 198 - 329
Target Start/End: Complemental strand, 47577241 - 47577110
Alignment:
| Q |
198 |
catgaaatgagaggtgtaaaggtccacctcatgagcagcagacaccggttatatcagtttgagattcagtttgttttcttttgtagcgtacggagcaagt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47577241 |
catgaaatgagaggtgtaaaggtccacctcatgagcagcagacaccggttatatcagtttgagattcagtttgttttcttttgtagcgtacggagcaagt |
47577142 |
T |
 |
| Q |
298 |
tgattggtttgtttcggttcgcatggaaaatg |
329 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
47577141 |
tgattggtttgtttcggtacgcatggaaaatg |
47577110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 13 - 132
Target Start/End: Complemental strand, 47577424 - 47577305
Alignment:
| Q |
13 |
aatatggcattgtaggtcccggtcggcgctcaaatgggtcctccatatcacttcttcaccaaccccacgtatacacatgtttttattccattctatgatc |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47577424 |
aatatggcattgtgggtcccggtcggcgctcaaatgggtcctccatatcacttcttcaccaaccccacgtatacacatgtttttattccattctatgatc |
47577325 |
T |
 |
| Q |
113 |
atataattatggtttaattg |
132 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47577324 |
atataattatggtttaattg |
47577305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University