View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7224_low_15 (Length: 265)
Name: NF7224_low_15
Description: NF7224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7224_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 5608138 - 5607941
Alignment:
| Q |
18 |
gaacaaggatcaatggagcaaactagtattattcattcacnnnnnnnnnccggcaaatacaagatactgagaaaagaatacaagacattgaattaaagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5608138 |
gaacaaggatcaatggagcaaactagtattattcattcactattttttttcggcaaatacaagatactgagaaaagaatacaagacattgaattaaagaa |
5608039 |
T |
 |
| Q |
118 |
ctgtattgaaactaagaaatcaataaaagactagggtcctatgtgacaccaacacagacacagacaccaaccctacgctctgagactagtaatgaatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
5608038 |
ctgtattgaaactaagaaatcaataaaagactggggtcctatgcgacaccaacacatacacagacaccaaccctacgctccaacactagtaatgaatt |
5607941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University