View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7224_low_16 (Length: 262)
Name: NF7224_low_16
Description: NF7224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7224_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 2517783 - 2517548
Alignment:
| Q |
8 |
tcaaggccttaagttatgatgttttcatgtgctaaatgactcctttctttgtttagtatctgctggctgtttggtcctacattctttttccgttttcttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517783 |
tcaaggccttaagttatgatgttttcatgtgctaaatgactcctttctttgtttagtatctgctggctgtttggtcctacattctttttccgttttcttc |
2517684 |
T |
 |
| Q |
108 |
ttttgttcagcctgctttggtttggaaaagaaccaatattgaatgagtcatgtacttattaggaactgaaagttcattgcttttatataattttcccatc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2517683 |
ttttgttcagcctgctttggtttggaaaagaaccaatattgaatgagtcatgtacttattaggaactgaaagttcattgcttttatataatcttcccatc |
2517584 |
T |
 |
| Q |
208 |
ttatagttatgatatcttctattttatgttttattt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2517583 |
ttatagttatgatatcttctattttatgttttattt |
2517548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University